ARTICLE
Age and sex-speci!c risks of myocarditis and
pericarditis following Covid-19 messenger RNA
vaccines
Stéphane Le Vu 1!, Marion Bertrand1, Marie-Joelle Jabagi 1, Jérémie Botton 1,2, Jérôme Drouin1,
Bérangère Baricault1, Alain Weill 1, Rosemary Dray-Spira 1 & Mahmoud Zureik1,
3
Cases of myocarditis and pericarditis have been reported following the receipt of Covid-19
mRNA vaccines. As vaccination campaigns are still to be extended, we aimed to provide a
comprehensive assessment of the association, by vaccine and across sex and age groups.
Using nationwide hospital discharge and vaccine data, we analysed all 1612 cases of myo-
carditis and 1613 cases of pericarditis that occurred in France in the period from May 12, 202
1
to October 31, 2021. We perform matched case-control studies and !nd increased risks of
myocarditis and pericarditis during the !rst week following vaccination, and particularly after
the second dose, with adjusted odds ratios of myocarditis of 8.1 (95% con!dence interval
[CI], 6.7 to 9.9) for the BNT162b2 and 30 (95% CI, 21 to 43) for the mRNA-1273 vaccine.
The largest associations are observed for myocarditis following mRNA-1273 vaccination in
persons aged 18 to 24 years. Estimates of excess cases attributable to vaccination also reveal
a substantial burden of both myocarditis and pericarditis across other age groups and in both
males and females.
https://doi.org/10.1038/s41467-022-31401-5 OPEN
1 EPIPHARE Scienti!c Interest Group in Epidemiology of Health Products, (French National Agency for the Safety of Medicines and Health Products – ANSM,
French National Health Insurance – CNAM), Saint-Denis, France. 2 Faculté de Pharmacie, Université Paris-Saclay, 92296 Châtenay-Malabry, France.
3 University Paris-Saclay, UVSQ, University Paris-Sud, Inserm, Anti-infective evasion and pharmacoepidemiology, CESP Montigny le Bretonneux, France.
!email: stephane.le-vu@ansm.sante.fr
NATURE COMMUNICATIONS | ��������(2022)�13:3633� | https://doi.org/10.1038/s41467-022-31401-5 | www.nature.com/naturecommunications 1
1
2
3
4
5
6
78
9
0
()
:,;
On July 19, 2021 the European Medicines Agency advised
that myocarditis and pericarditis be added to the list of
adverse effects of both messenger RNA (mRNA) based
vaccines (BNT162b2 [P!zer–BioNTech] and mRNA-1273
[Moderna]) against coronavirus disease 2019 (Covid-19)1. This
statement followed pharmacovigilance reports of an increased
risk of myocarditis among recipients of mRNA vaccines that
showed certain common patterns2,3. Several reports indicate that
adverse events typically occur within a week after injection,
mostly after the second dose of vaccine, cluster in young males,
and result in a mild clinical course and short duration of
hospitalization4–6. However, the predominance of a vaccine-
associated risk in males7 and its extent regarding pericarditis, as a
speci!c condition, remains uncertain8–11. Population-based risks
estimates for each condition and across sex and age groups and
by vaccine type remains crucial as vaccination campaigns are still
to be extended especially towards the youngest and with sub-
sequent doses. The Covid-19 vaccination campaign began in
France in late 2020 with the gradual roll-out of the two mRNA
vaccines, BNT162b2 and mRNA-1273 alongside viral vector-
based vaccines. Initially reserved for the oldest and most vul-
nerable groups, as well as healthcare professionals, vaccination
was opened up to the entire population over the age of 18 years as
of May 12, 2021, and to all over 12 years old as of June 15, 2021.
As of October 31, 2021 approximately 50 million people (88% of
the eligible population, i.e. over 12 years old) in France had
received a full vaccination schedule12. Here, we aimed to estimate
the age and sex-speci!c associations between each mRNA Covid-
19 vaccine and the risk of myocarditis and pericarditis, using
nationwide hospital discharge and vaccine data for France.
Results
Characteristics of the study population. Between May 12, 2021
and October 31, 2021, within a population of 32 million persons
aged 12 to 50 years, 21.2 million !rst (19.3 million second) doses
of the BNT162b2 vaccine and 2.86 million !rst (2.58 million
second) doses of the mRNA-1273 vaccine were received
(Table S1). In the same period, 1612 cases of myocarditis (of
which 87 [5.4%] had also a pericarditis as associated diagnosis)
and 1613 cases of pericarditis (37 [2.3%] with myocarditis as
associated diagnosis) were recorded in France. We matched those
cases to 16,120 and 16,130 control subjects, respectively. The
characteristics of the cases and their matched controls are shown
in Table 1. For both myocarditis and pericarditis, key differences
between cases and controls included a higher proportion among
cases of a history of myocarditis or pericarditis, of history of
SARS-CoV-2 infection, and receipt of an mRNA Covid-19 vac-
cine. The mean age and proportion of women were lower among
patients with myocarditis than those with pericarditis.
Risk of myocarditis and pericarditis associated with vaccina-
tion. For both vaccines, the risk of myocarditis was increased in
the seven days post vaccination (Table 2; in the rest of the text, we
will refer to multivariable odds ratios). For the BNT162b2 vac-
cine, odds ratios were 1.8 (95% con!dence interval [CI]: 1.3–2.5)
for the !rst dose and 8.1 (95% CI, 6.7–9.9) for the second. The
association was stronger for the mRNA-1273 vaccine with odds-
ratios of 3.0 (95% CI, 1.4–6.2) for the !rst dose and 30 (95% CI,
21–43) for the second. The risk of pericarditis was increased in
the seven days following the second dose of both vaccines, with
odds ratios of 2.9 (95% CI, 2.3–3.8) for the BNT162b2 vaccine
and 5.5 (95% CI, 3.3–9.0) for the mRNA-1273 vaccine. Vacci-
nation in the previous 8 to 21 days, with either the BNT162b2 or
mRNA-1273 vaccine was not associated with a risk of myocarditis
or pericarditis. Independently of vaccination status, a history of
myocarditis was strongly associated with a risk of contracting
myocarditis during the study period, with an odds-ratios of 160
(95% CI, 83–330). The same was true for pericarditis, with an
odds ratio of 250 (95% CI, 120–540). No interaction was found
between history of myocarditis or pericarditis and vaccine
exposure. Infection with SARS-CoV-2 in the preceding month
was also associated with a risk of myocarditis (odds ratio, 9.0
[95% CI, 6.4–13]) or pericarditis (odds ratio, 4.0 [95% CI,
2.7–5.9]).
Subgroup estimates by sex and age classes. The risk of myo-
carditis was substantially increased within the !rst week post
vaccination in both males and females (Fig. 1 and Table S2).
Odds-ratios associated with the second dose of the mRNA-1273
vaccine were consistently the highest, with values up to 44 (95%
CI, 22–88) and 41 (95% CI, 12–140), respectively in males and
females aged 18 to 24 years but remaining high in older age
groups. Odds-ratios for the second dose of the BNT162b2 vaccine
tended to decrease with age, from 18 (95% CI, 9–35) and 7.1 (95%
CI, 1.5–33), respectively in males and females aged 12 to 17 years,
down to 3.0 (95% CI, 1.5–5.9) and 1.9 (95% CI, 0.39–9.3),
respectively in males and females aged 40 to 51 years.
An increased risk of pericarditis was also found in the !rst
week after the second dose of either of the mRNA vaccines
among both males and females (Fig. 2 and Table S3). Odds-ratios
for the second dose of the BNT162b2 vaccine showed a
downward trend across age groups with values up to 6.8 (95%
CI, 2.3–20) and 10 (95% CI, 2.5–41), respectively in males and
females aged 12 to 17 years. The second dose of the mRNA-1273
vaccine was associated with pericarditis among males and among
females only within age 30 to 39 years (odds-ratio 20 [95% CI,
3.5–110]) and age 40 to 50 years (odds-ratio 13 [95% CI, 3.5–49]).
Associations between vaccination within the seven preceding
days and the risk of myocarditis or pericarditis were of the same
magnitude when the analysis was restricted to the period prior to
the warning against myocarditis and pericarditis as adverse events
sent to prescribers on July 19, 2021 (Fig. S1 and Table S4). The
results were unchanged in models excluding patients with a
history of SARS-CoV-2 infection in the past month, those with a
history of myocarditis or pericarditis within !ve years, those
diagnosed with both myocarditis and pericarditis, or those with a
hospitalization within a month prior to index date.
Excess events. We estimated the number of excess cases attri-
butable to vaccines by sex and age group (Fig. 3). The number of
excess cases of myocarditis per 100,000 doses administered to
adolescent males 12 to 17 years was 1.9 (95% CI, 1.4–2.6) for the
second dose of the BNT162b2 vaccine and for young adults 18 to
24 years of age reached 4.7 (95% CI, 3.8–5.8) for the second dose
of the BNT162b2 vaccine, and 17 (95% CI, 13–23) for the second
dose of the mRNA-1273 vaccine (Fig. 3). This translates into one
case of vaccine-associated myocarditis per 52,300 (95% CI,
38,200–74,100) second doses of the BNT162b2 vaccine among
12–17 years, and 21,100 (95% CI, 17,400–26,000) second doses of
the BNT162b2 vaccine and 5900 (95% CI, 4400–8000) second
doses of the mRNA-1273 vaccine among 18–24 years (Table S5).
Estimates of excess cases were lower for older age groups and
generally for females. However, the number of excess cases of
myocarditis attributable to the second dose of the mRNA-1273
vaccine was consistently higher. Among females aged 18 to 24
years, the estimated number of excess cases of myocarditis per
100,000 doses reached 0.63 (95% CI, 0.34–1.1) for the second
dose of the BNT162b2 vaccine (corresponding to 1 case per
159,000 [95% CI, 90,800–294,400] doses) and 5.3 (95% CI,
3.0–9.1) for the second dose of the mRNA-1273 vaccine
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-31401-
5
2 NATURE COMMUNICATIONS | ��������(2022)�13:3633� | https://doi.org/10.1038/s41467-022-31401-5 | www.nature.com/naturecommunications
(corresponding to 1 case per 18,700 [95% CI, 11,000–33,400]
doses). The number of excess cases of pericarditis is presented in
Fig. 3. As for myocarditis, estimates for the second dose of the
mRNA-1273 vaccine were consistently higher.
Characteristics of myocarditis and pericarditis cases occurring
after vaccination. Among exposed cases, the delay between
administration of the vaccine and hospitalization (Fig. S2) was
shorter after the second dose than after the !rst dose, both for
myocarditis (median of 4 days versus 10 days after the BNT162b2
vaccine and of 3.5 days versus 9 days after the mRNA-1273
vaccine) and for pericarditis (median of 6 days versus 10 days
after the BNT162b2 vaccine and of 3 days versus 11 days after the
mRNA-1273 vaccine).
Table 3 shows the characteristics of cases acquired within
7 days of vaccination (deemed post-vaccination cases) compared
to those acquired within a larger delay or in the absence of
vaccination. Post-vaccination cases were signi!cantly younger
(predominantly in 18 to 24 years), more frequently concerned
males for myocarditis but not for pericarditis, and without a
history of myocarditis or pericarditis, respectively, or of SARS-
CoV-2 infection. The lengths of hospital stay were not
signi!cantly different in post-vaccination cases of myocarditis
(median 4 days) and pericarditis (median 2 days) than in
unexposed cases. The frequency of admission in intensive care
unit, mechanical ventilation or death was lower for post-
vaccination cases than for unexposed cases. After a follow-up of
30 days after discharge, 4 (0.24%) deaths among cases of
Table 1 Characteristics of study cases and controls.
Myocarditis
Pericarditis
Cases Controls Cases Controls
(N= 1612) (N= 16,120) (N= 1613) (N= 16,130)
Sex
Male 1281 (79.5) 12,810 (79.5) 989 (61.3) 9890 (61.3)
Female 331 (20.5) 3310 (20.5) 624 (38.7) 6240 (38.7)
Agea
Mean (sd) 27.8 (9.51) 27.8 (9.51) 33.4 (10.3) 33.4 (10.3)
Median (range) 25.0 (20.0–34.3) 25.0 (20.0–34.3) 34.0 (24.0–42.0) 34.0 (24.0–42.0)
Age distributiona
12–17 166 (10.3) 1660 (10.3) 101 (6.3) 1010 (6.3)
18–24 586 (36.4) 5860 (36.4) 312 (19.3) 3120 (19.3)
25–29 250 (15.5) 2500 (15.5) 197 (12.2) 1970 (12.2)
30–39 361 (22.4) 3610 (22.4) 465 (28.8) 4650 (28.8)
40–50 249 (15.4) 2490 (15.4) 538 (33.4) 5380 (33.4)
Deprivation Indexb
Most deprived 986 (61.2) 9567 (59.3) 1049 (65.0) 10,080 (62.5)
Least deprived 626 (38.8) 6553 (40.7) 564 (35.0) 6050 (37.5)
History of myocarditis or pericarditisc 126 (7.8) 9 (0.1) 173 (10.7) 8 (0.0)
History of SARS-CoV-2 infectiond 64 (4.0) 107 (0.7) 42 (2.6) 110 (0.7)
Receipt of mRNA vaccine 950 (58.9) 7837 (48.6) 906 (56.2) 8436 (52.3)
aAt index date (date of hospital admission for myocarditis for case patients and date of selection for matched control individuals).
bLeast deprived refers to the grouping of 1st and 2nd quintiles, and most deprived to the grouping of 3d to 5th quintiles of the deprivation index.
cDe!ned as an hospitalization with the respective condition within past 5 years.
dEither a positive RT-PCR or antigenic test for SARS-CoV-2, or hospitalization for COVID-19, within 30 days prior to index date.
Table 2 Association between myocarditis and pericarditis and exposure to mRNA vaccines within 1 to 7 days and 8 to 21 days.
Myocarditis Pericarditis
Cases Controls OR (95% CI)a aOR (95% CI)b Cases Controls OR (95% CI)a aOR (95% CI)b
Unexposed Daysc 1078 13342 Reference Reference 1269 13398 Reference Reference
BNT162b2
Dose 1 1–7 51 370 1.7 (1.3–2.4) 1.8 (1.3–2.5) 43 398 1.1 (0.83–1.6) 1.3 (0.92–1.8)
8–21 71 855 1.1 (0.86–1.4) 1.2 (0.93–1.6) 72 824 0.94 (0.73–1.2) 0.93 (0.72–1.2)
Dose 2 1–7 211 439 6.9 (5.7–8.4) 8.1 (6.7–9.9) 93 374 2.7 (2.2–3.5) 2.9 (2.3–3.8)
8–21 72 816 1.2 (0.95–1.6) 1.3 (0.98–1.7) 80 765 1.2 (0.91–1.5) 1.3 (0.98–1.6)
mRNA-1273
Dose 1 1–7 9 48 2.4 (1.2–5) 3 (1.4–6.2) 8 78 1.1 (0.52–2.2) 1.2 (0.56–2.4)
8–21 10 109 1.2 (0.63–2.3) 1.1 (0.55–2.3) 9 146 0.65 (0.33–1.3) 0.73 (0.37–1.4)
Dose 2 1–7 106 51 27 (19–39) 30 (21–43) 26 54 5.3 (3.3–8.4) 5.5 (3.3–9)
8–21 4 89 0.68 (0.25–1.9) 0.59 (0.19–1.9) 11 89 1.4 (0.72–2.5) 1.5 (0.76–2.9)
History of myocarditis or pericarditisd
No 1486 16111 Reference Reference 1440 16122 Reference Reference
Yes 126 9 140 (71–280) 160 (83–330) 173 8 250 (120–520) 250 (120–540)
History of SARS-CoV-2 infectione
No 1548 16013 Reference Reference 1571 16020 Reference Reference
Yes 64 107 6.3 (4.6–8.6) 9 (6.4–13) 42 110 3.9 (2.7–5.7) 4 (2.7–5.9)
Deprivation Indexf
Most deprived 986 9567 Reference Reference 1049 10080 Reference Reference
Least deprived 626 6553 0.9 (0.8–1) 0.88 (0.77–1) 564 6050 0.87 (0.77–0.98) 0.87 (0.76–0.99)
aOdds-ratio (95% con!dence interval) were obtained from univariable conditional logistic regression, adjusting for matching variables (sex, age and department of residence).
bAdjusted odds-ratio (95% con!dence interval) were obtained from multivariable conditional logistic regression, adjusting for all covariates and matching variables.
cPeriod of vaccine receipt relative to index date.
dDe!ned as an hospitalization with the respective condition within past 5 years.
eEither a positive RT-PCR or antigenic test for SARS-CoV-2, or hospitalization for COVID-19, within 30 days prior to index date.
fLeast deprived refers to the grouping of 1st and 2nd quintiles, and most deprived to the grouping of 3d to 5th quintiles of the deprivation index.
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-31401-5 ARTICLE
NATURE COMMUNICATIONS | ��������(2022)�13:3633� | https://doi.org/10.1038/s41467-022-31401-5 | www.nature.com/naturecommunications 3
Male Female
D
ose 1
D
ose 2
12!17 18!24 25!29 30!39 40!50 12!50 12!17 18!24 25!29 30!39 40!50 12!50
1
10
100
1
10
100
Age
aO
R
BNT162b2 mRNA!1273
Fig. 1 Association between myocarditis and exposure to mRNA vaccines within 7 days, according to sex and age group. Adjusted odds-ratio (aOR) from
multivariable model are represented in base 10 logarithmic scale according to age groups (x-axis), by sex (columns) and vaccine dose ranking (rows).
Colors denote the type of vaccine. Centre value are aOR point estimates and error bars represent 95% con!dence intervals. Number of cases (N) by age
categories (12–17, 18–24, 25–29, 30–39, 40–50 and 12–50 years) are respectively as follows: N= 137, 480, 210, 273, 181 and 1281 for males, and N= 29,
106, 40, 88, 68 and 331 for females. aOR could not be calculated in categories where no case exposed to vaccine was recorded, for instance for males and
females aged 12 to 17 years having received the mRNA-1273 vaccine.
Male Female
D
ose 1
D
ose 2
12!17 18!24 25!29 30!39 40!50 12!50 12!17 18!24 25!29 30!39 40!50 12!50
1
10
1
10
100
Age
aO
R
BNT162b2 mRNA!1273
Fig. 2 Association between pericarditis and exposure to mRNA vaccines within 7 days, according to sex and age group. Adjusted odds-ratio (aOR) from
multivariable model are represented in base 10 logarithmic scale according to age groups (x-axis), by sex (columns) and vaccine dose ranking (rows).
Colors denote the type of vaccine. Centre value are aOR point estimates and error bars represent 95% con!dence intervals. Number of cases (N) by age
categories (12–17, 18–24, 25–29, 30–39, 40–50 and 12–50 years) are respectively as follows: N= 65, 194, 106, 282, 342 and 989 for males, and N= 36,
118, 91, 183, 196 and 624 for females. aOR could not be calculated in categories where no case exposed to vaccine was recorded, for instance for males and
females aged 12 to 17 years having received the mRNA-1273 vaccine.
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-31401-5
4 NATURE COMMUNICATIONS | ��������(2022)�13:3633� | https://doi.org/10.1038/s41467-022-31401-5 | www.nature.com/naturecommunications
myocarditis (none among exposed to vaccine) and 5 (0.31%)
deaths among cases of pericarditis (including one patient having
received a vaccine 8 to 21 days prior to the diagnosis) were
reported. Of those, 3 and 2 died during their hospital stay for
myocarditis and pericarditis, respectively.
Drugs treatments within 30 days after hospital discharge are
presented in Figs. S3 and S4. Regardless of the vaccination status,
the therapeutic classes most frequently used during the follow-up
of myocarditis cases included beta blocking agents (63% of
patients), analgesics (52%) and agents acting on the renin
!angiotensin system (46%). The corresponding treatments of
pericarditis cases were analgesics (83%), colchicine (69%) and
beta blocking agents (14%) (Fig. S4).
Discussion
In this nationwide study involving a population of 32 million
people aged 12 to 50 years having received 46 million doses of
mRNA vaccines, we provide detailed estimates of the risk of
myocarditis and pericarditis by sex, age categories and vaccine
type. We !nd that vaccination with both mRNA vaccines was
associated with an increased risk of myocarditis and pericarditis
within the !rst week after vaccination. The associations were
particularly pronounced after the second dose, and were evident
in both males and females. We found a trend of increased risks
towards younger age groups but a signi!cant risk was also found
in males over 30 years to develop myocarditis and in females over
30 years to develop a pericarditis after vaccination. Reassuringly,
these cases of myocarditis and pericarditis, although requiring
hospitalization, did not result in more severe outcomes than those
unrelated to vaccination.
Our results are generally consistent with those reported by the
pharmacovigilance systems in France and other countries8,13–16.
Several common factors in terms of the characteristics and
prognosis of cases identi!ed, and the temporal relationship
Male Female
12!17 18!24 25!29 30!39 40!50 12!50 12!17 18!24 25!29 30!39 40!50 12!50
0.0
2.5
5.0
7.5
0
5
10
15
20
E
xc
es
s
ca
se
s
pe
r
10
0,
00
0
do
se
s
Myocarditis
Male Female
12!17 18!24 25!29 30!39 40!50 12!50 12!17 18!24 25!29 30!39 40!50 12!50
0
1
2
3
0
2
4
6
Age
E
xc
es
s
ca
se
s
pe
r
10
0,
00
0
do
se
s
Pericarditis
BNT162b2 mRNA!1273 Dose 1 Dose 2
Fig. 3 Excess cases of myocarditis and pericarditis attributable to mRNA vaccines according to sex and age group, per 100,000 doses. Excess cases
are based on the risk in the 7 days following vaccination. Colors denote the type of vaccine and the shape of point estimate denotes the ranking of dose
vaccine. Centre value are excess cases point estimates and error bars represent 95% con!dence intervals. Number of cases (N) by age categories (12–17,
18–24, 25–29, 30–39, 40–50 and 12–50 years) are respectively as follows: for cases of myocarditis, N= 137, 480, 210, 273, 181 and 1281 in males, and
N= 29, 106, 40, 88, 68 and 331 in females; for cases of pericarditis, N= 65, 194, 106, 282, 342 and 989 in males, and N= 36, 118, 91, 183, 196 and 624 in
females. Excess cases was only calculated in categories with a signi!cantly positive association between the vaccine exposure and the outcome (adjusted
odds-ratio >1).
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-31401-5 ARTICLE
NATURE COMMUNICATIONS | ��������(2022)�13:3633� | https://doi.org/10.1038/s41467-022-31401-5 | www.nature.com/naturecommunications 5
between vaccine exposure and the event of interest, suggest a
consistent underlying mechanism5,6,17,18. As found in our ana-
lyses, various reports indicate that the risk is more pronounced
with the mRNA-1273 vaccine7,10,19,20, even though there was no
difference in rates between the two vaccines in the passive sur-
veillance reporting in the US4.
Our !ndings bring new elements in showing that the risk of
acute cardiac in”ammation after vaccination is not con!ned to
myocarditis in young men4–6,14. First, in line with results from a
cohort study in Nordic countries11, our analyses show a sig-
ni!cant risk and population burden of pericarditis following the
second dose of the BNT162b2 and mRNA-1273 vaccine. Often
comprised in a combined outcome of myopericarditis7,19,21,
pericarditis as speci!c entity has been less studied for its asso-
ciation with mRNA vaccines, and even more rarely regarding the
mRNA-12173 vaccine. For the BNT162b2 vaccine, results are
inconsistent with either reports of a positive association11,18 or an
absence of association8–10. Barda et al. and Lai et al. found a non-
signi!cant risk ratio of 1.27 and odds ratio of 1.06, respectively,
for the combined effect of !rst and second dose of the BNT162b2
vaccine8,9. Patone et al. found a non-signi!cant relative incidence
of pericarditis in the week after both doses of the BNT162b2
vaccine of approximately 0.6, while the association with mRNA-
1273 could not be quanti!ed10. Considering that the risk of
myocarditis following the BNT162b2 vaccine is also found lower
in the later study than in others, we hypothesized that the
probably weaker association with pericarditis might be more
dif!cult to reveal. This discrepancy could also re”ect different
diagnostic practices as pericarditis is a retrospective diagnosis of
exclusion.
Second, by differentiating the risk between adolescent (aged
12 to 17 years) and young men or women (18–25 years), we
estimate that the number of excess cases after the second dose
of BNT162b2 vaccine is lower in adolescents compared to
young adults. This is consistent with !ndings from surveillance
data in Israel22 but in contrast with those from the US4. There
is some support for the role of sex hormones in the increased
susceptibility for myocarditis of young men compared to
women23–25. While we do !nd higher absolute burden of
myocarditis and pericarditis in adolescent males and men, we
also !nd that the female counterpart also faces a signi!cant
risk, notably of pericarditis for women over 30 years after the
second dose of the mRNA-1273 vaccine, which has not yet
been shown.
There are several factors that support the hypothesis of a causal
relationship between exposure to mRNA vaccines and the risk of
myocarditis and pericarditis. First, the associations remained
strong, even after adjusting for a history of these conditions or
Table 3 Description of hospitalized patients according to the exposure to mRNA vaccines.
Myocarditis Pericarditis
Unexposed Vaccinated within
1 to 7 days
Vaccinated within
8 to 21 days
Unexposed Vaccinated within
1 to 7 days
Vaccinated within
8 to 21 days
(N= 1077) (N= 378) (N= 157) (N= 1267) (N= 172) (N= 174)
Sex
Male 829 (77.0) 324 (85.7) 128 (81.5) 778 (61.4) 101 (58.7) 110 (63.2)
Female 248 (23.0) 54 (14.3) 29 (18.5) 489 (38.6) 71 (41.3) 64 (36.8)
Agea
Mean (sd) 28.5 (9.74) 25.6 (8.44) 28.6 (9.53) 33.8 (10.3) 29.9 (10.0) 33.9 (10.0)
Median (range) 26.0 (21.0–36.0) 23.0 (19.0–30.8) 26.0 (20.0–37.0) 35.0 (25.0–43.0) 29.0 (21.0–38.0) 34.0 (26.0–42.0)
Age distributiona
12–17 114 (10.6) 40 (10.6) 12 (7.6) 80 (6.3) 12 (7.0) 9 (5.2)
18–24 356 (33.1) 171 (45.2) 59 (37.6) 228 (18.0) 56 (32.6) 28 (16.1)
25–29 168 (15.6) 60 (15.9) 22 (14.0) 152 (12.0) 22 (12.8) 23 (13.2)
30–39 248 (23.0) 74 (19.6) 39 (24.8) 361 (28.5) 47 (27.3) 57 (32.8)
40–50 191 (17.7) 33 (8.7) 25 (15.9) 446 (35.2) 35 (20.3) 57 (32.8)
Deprivation Indexb
Most deprived 654 (60.7) 237 (62.7) 95 (60.5) 820 (64.7) 115 (66.9) 114 (65.5)
Least deprived 423 (39.3) 141 (37.3) 62 (39.5) 447 (35.3) 57 (33.1) 60 (34.5)
History of myocarditis
or pericarditisc
104 (9.7) 12 (3.2) 10 (6.4) 149 (11.8) 10 (5.8) 14 (8.0)
History of SARS-CoV-2
infectiond
58 (5.4) 2 (0.5) 4 (2.5) 39 (3.1) 0 (0) 3 (1.7)
Length of hospital stay
Mean (sd) 4.56 (5.97) 3.75 (2.60) 4.18 (2.70) 2.84 (4.46) 2.36 (2.49) 2.52 (2.84)
Median (range) 4.00 (2.00–5.00) 4.00 (2.00–5.00) 4.00 (3.00–5.00) 1.00 (0–4.00) 2.00 (1.00–4.00) 2.00 (1.00–3.00)
Death up to 30 days
after discharge
4 (0.4) 0 (0) 0 (0) 4 (0.3) 0 (0) 1 (0.6)
among which
deceased during
hospital stay
3 (0.3) 0 (0) 0 (0) 1 (0.1) 0 (0) 1 (0.6)
Intensive care unit 66 (6.1) 9 (2.4) 6 (3.8) 32 (2.5) 0 (0) 2 (1.1)
Ventilation – oxygen
therapy
46 (4.3) 12 (3.2) 5 (3.2) 30 (2.4) 1 (0.6) 3 (1.7)
Pericardial drainage 3 (0.3) 0 (0) 0 (0) 38 (3.0) 1 (0.6) 2 (1.1)
aAt index date (date of hospital admission for myocarditis or pericarditis).
bLeast deprived refers to the grouping of 1st and 2nd quintiles, and most deprived to the grouping of 3d to 5th quintiles of the deprivation index.
cDe!ned as an hospitalization with the respective condition within past 5 years.
dEither a positive RT-PCR or antigenic test for SARS-CoV-2, or hospitalization for COVID-19, within 30 days prior to index date.
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-31401-5
6 NATURE COMMUNICATIONS | ��������(2022)�13:3633� | https://doi.org/10.1038/s41467-022-31401-5 | www.nature.com/naturecommunications
recent SARS-CoV-2 infection, and in a period during which most
common respiratory viruses were not widely circulating26,27.
Second, the time that elapsed between exposure to the vaccine
and hospitalization was very short for both conditions, particu-
larly after the second dose. Third, in most cases, the associations
did not persist after seven days following exposure. Fourth, the
stronger risk associated with the second dose and the mRNA-
1273 vaccine, which contains a larger amount of mRNA, suggest
a dose response relationship28.
The strengths of our study include the large sample size,
population-based character and the assessment of cases and
exposure to vaccines in high-quality and comprehensive data-
bases. It allowed us to include 1612 con!rmed cases of myo-
carditis and 1613 of pericarditis, occurring in a period during
which 46 million doses of the two mRNA vaccines were admi-
nistered. This study provides population estimates of vaccine
associated risk and burden at a national level, which cannot be
informed by passive case noti!cation surveillance. Furthermore,
results were consistent after adjusting for other risk factors,
including SARS-CoV-2 infection, and different periods.
Our study has several limitations. First, the National Health
Data System provides little clinical and no laboratory information
concerning cases. The cases included in this study were identi!ed
solely on the basis of the diagnosis codes associated with hospital
admissions. We therefore could not detect asymptomatic or mild
forms of myocarditis and pericarditis that would not require
hospitalization. Nevertheless, the incidence of myocarditis and
pericarditis before the Covid-19 pandemic, estimated using the
SNDS data, is consistent with the !gures reported by other
countries14. Furthermore, the observed durations of stay and
post-discharge treatments were consistent with typical presenta-
tions of these conditions. Second, while our assessment of severity
indicators within four weeks post-discharge indicates a favourable
clinical outcome of post-vaccination carditis in their acute phase,
we could not investigate potential long-term consequences. Third,
we did not study the Covid-19 booster vaccination which was not
yet recommended for healthy younger adults in our study period.
Finally, associations across age and sex subgroups could not
always be quanti!ed for both vaccines or only with a considerable
degree of uncertainty due to the limited time span of observation.
The extent of the risk for certain subgroups, especially among
women, for whom the incidence appears to be lower, warrants
further studies and meta-analyses26,29.
In conclusion, this study provides strong evidence of an
increased risk of myocarditis and of pericarditis in the week
following vaccination against Covid-19 with mRNA vaccines in
both males and females, in particular after the second dose of the
mRNA-1273 vaccine. Future studies based on an extended period
of observation will allow to investigate the risk related to the
booster dose of the vaccines and monitoring the long-term con-
sequences of these post vaccination acute in”ammations.
Methods
Study design. We conducted a matched case-control study within the entire
French population between 12 and 50 years of age for myocarditis and pericarditis,
treating each condition separately. The study focused on the period from May 12,
2021, to October 31, 2021, during which the Covid-19 vaccination campaign was
opened to individuals under 50 years of age.
Data sources and study population. The study was based on data of the National
Health Data System (SNDS) which covers more than 99% of the French population
(67 million inhabitants)30,31. Data on hospital admission were obtained from the
French hospital discharge database (PMSI) and linked at the individual level with
the nationwide databases for Covid-19 vaccination (VAC-SI) and testing (SI-DEP).
Cases corresponded to all patients admitted to French hospitals with a diagnosis of
myocarditis or pericarditis in the study period. Diagnoses at hospital were typically
based on presenting symptoms, electrocardiography, echocardiography and cardiac
magnetic resonance imaging32,33. We used the codes for myocarditis (I40.x, I41.x,
and I51.4) and pericarditis (I30.x and I32.x) of the International Classi!cation of
diseases, 10th revision (ICD-10) for detection. Although the data were compre-
hensive up to September 2021, at the time this study was conducted, approximately
78% of hospital stays for October 2021 had been entered into the PMSI database.
Each case was matched at the date of his/her hospital admission for myocarditis or
pericarditis (index date) to 10 control individuals. Controls were selected from
among the whole population by simple random sampling without replacement
within each stratum of age, gender and area of residence (matching criteria), with
constraint of not being diagnosed with myocarditis or pericarditis and being alive
at the index date.
Our research group (EPI-PHARE) has a regulatory permanent access to the
data from the SNDS. This permanent access is given according the French Decree
No. 2016-1871 of December 26, 2016 relating to the processing of personal data
called “National Health Data System” and French law articles Art. R. 1461-13 and
14. This study was declared prior to initiation on the EPI-PHARE registry of
studies requiring the use of the SNDS (n° EP-0311). No informed consent was
required because data are anonymized.
Exposure and covariates. Exposure was de!ned as vaccination with an mRNA
vaccine 1 to 7 days or 8 to 21 days prior to the index date, considering the !rst and
second dose separately. Non-vaccinated subjects, and those vaccinated more than
21 days before the index date were considered to be non-exposed. In addition to the
matching variables, three covariates potentially associated with a risk of myocarditis
or pericarditis, and with vaccine exposure were considered. A prior history of
myocarditis or pericarditis was de!ned as a hospital admission with an ICD-10 code
for myocarditis or pericarditis (cf. above) in the !ve years preceding the index date. A
history of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection
was de!ned by hospital admission for Covid-19 or a positive polymerase-chain-
reaction (PCR) or antigenic testing 30 days prior to the index date. The socio-
economic level was de!ned by a deprivation index, summarized in two categories34.
Statistical analysis. We used conditional logistic regression models to estimate
the odds ratios (OR) of myocarditis and pericarditis associated with exposure to
recent vaccination, adjusted for covariates and matching variables35. Analyses
were conducted with reference to the ranking of vaccine dose (!rst or second
dose) and the time elapsed since vaccination (1 to 7 days or 8 to 21 days), across
the study group as a whole and separately for males and females and according
to !ve age brackets (12–17, 18–24, 25–29, 30–39 and 40 to 50 years). Associa-
tions were measured relative to the most recent exposure. We estimated the
number of cases attributable to vaccine exposure using the odds ratio as an
estimate of relative risk and assuming a causal relationship36. We then derived
two measures of population burden using information on exposure to vaccines
across the 32.2 million people aged 12 to 50 years, including the vaccine type
and date of receipt of each dose (Table S1). First, the number of doses required
for the occurrence of a vaccine-associated case was estimated as the ratio of
doses administered to the number of attributable cases. Second, the number of
excess cases per 100,000 doses was derived by inverting this ratio. We applied a
correction factor to the numbers of exposed cases to account for under-reporting
of hospitalizations in October 2021. Con!dence intervals for the number of cases
attributable to exposure were obtained by application of the delta-method37,38.
We assessed the sensitivity of the results to a potential ascertainment bias by
performing an analysis restricted to the time period before July 19, 2021, i.e.
before myocarditis and pericarditis were of!cially announced as adverse events
of mRNA vaccines. Additional analyses were conducted by excluding (i) patients
with a previous history of myocarditis or pericarditis, (ii) those with a history of
SARS-CoV-2 infection, (iii) patients having both diagnoses of myocarditis and
pericarditis, and (iv) persons with a hospitalization within 28 days of index date.
Data collection used SAS Enterprise Guide version 4.3 software (SAS Institute,
Cary, North Carolina). All analyses were performed using R software version
4.1.3, and survival package version 3.2–1339,40.
Reporting summary. Further information on research design is available in the Nature
Research Reporting Summary linked to this article.
Data availability
According to data protection and the French regulation, the authors cannot publicly
release the data from the French national health data system (SNDS). However, any
person or structure, public or private, for-pro!t or non-pro!t, is able to access SNDS data
upon authorization from the French Data Protection Of!ce (CNIL Commission
Nationale de l’Informatique et des Libertés) to carry out a study, a research, or an
evaluation of public interest (https://www.snds.gouv.fr/SNDS/Processus-d-acces-aux-
donnees and https://www.indsante.fr/).
Code availability
The code to reproduce the analyses presented in the paper is publicly available41.
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-31401-5 ARTICLE
NATURE COMMUNICATIONS | ��������(2022)�13:3633� | https://doi.org/10.1038/s41467-022-31401-5 | www.nature.com/naturecommunications 7
Received: 25 February 2022; Accepted: 15 June 2022;
References
1. Meeting highlights from the Pharmacovigilance Risk Assessment Committee
(PRAC) 3–6 May 2021. https://www.ema.europa.eu/en/news/meeting-
highlights-pharmacovigilance-risk-assessment-committee-prac-3-6-may-2021
(2021).
2. Gargano, J. W. et al. Use of mRNA COVID-19 vaccine after reports of
myocarditis among vaccine recipients: update from the Advisory Committee
on Immunization Practices — United States, June 2021. MMWR Morb.
Mortal. Wkly. Rep. 70, 977–982 (2021).
3. Surveillance of Myocarditis (In!ammation of the Heart Muscle) Cases Between
December 2020 and May 2021 (Including). https://www.gov.il/en/departments/
news/01062021-03 (2021).
4. Oster, M. E. et al. Myocarditis cases reported after mRNA-Based COVID-19
vaccination in the US From December 2020 to August 2021. JAMA 327,
331–340 (2022).
5. Mevorach, D. et al. Myocarditis after BNT162b2 mRNA vaccine against
Covid-19 in Israel. N. Engl. J. Med. 2140–2149 https://doi.org/10.1056/
NEJMoa2109730 (2021).
6. Witberg, G. et al. Myocarditis after Covid-19 vaccination in a Large Health
Care Organization. N. Engl. J. Med. 2132–2139 https://doi.org/10.1056/
NEJMoa2110737 (2021).
7. Husby, A. et al. SARS-CoV-2 vaccination and myocarditis or myopericarditis:
population based cohort study. BMJ e068665 https://doi.org/10.1136/bmj-
2021-068665 (2021).
8. Barda, N. et al. Safety of the BNT162b2 mRNA Covid-19 Vaccine in a
Nationwide Setting. N. Engl. J. Med. 1078–1090 https://doi.org/10.1056/
NEJMoa2110475 (2021).
9. Lai, F. T. T. et al. Carditis after COVID-19 vaccination with a messenger RNA
vaccine and an inactivated virus vaccine. Ann. Intern. Med. https://doi.org/10.
7326/M21-3700 (2022).
10. Patone, M. et al. Risks of myocarditis, pericarditis, and cardiac arrhythmias
associated with COVID-19 vaccination or SARS-CoV-2 infection. Nat. Med.
1–13 https://doi.org/10.1038/s41591-021-01630-0 (2021).
11. EMA. Signal assessment report on Myocarditis, pericarditis with Tozinameran.
https://www.ema.europa.eu/documents/prac-recommendation/signal-
assessment-report-myocarditis-pericarditis-tozinameran-covid-19-mrna-
vaccine_en (2021).
12. Le tableau de bord de la vaccination. https://solidarites-sante.gouv.fr/grands-
dossiers/vaccin-covid-19/article/le-tableau-de-bord-de-la-vaccination (2021).
13. Enquête de pharmacovigilance du vaccin COVID!19 VACCINE MODERNA.
https://ansm.sante.fr/uploads/2021/10/22/20211021-covid-19-vaccins-
moderna-focus-1-2 (2021).
14. Bozkurt, B., Kamat, I. & Hotez, P. J. Myocarditis with COVID-19 mRNA
vaccines. Circulation 144, 471–484 (2021).
15. Klein, N. Myocarditis Analyses in the Vaccine Safety Datalink: Rapid Cycle
Analyses and “Head-to-Head” Product Comparisons. https://www.cdc.gov/
vaccines/acip/meetings/downloads/slides-2021-10-20-21/08-COVID-Klein-
508 (2021).
16. Dagan, N., Barda, N. & Balicer, R. D. Adverse effects after BNT162b2 vaccine
and SARS-CoV-2 infection, according to age and sex. N. Engl. J. Med. 2299
https://doi.org/10.1056/NEJMc2115045 (2021).
17. Klein, N. P. et al. Surveillance for adverse events after COVID-19 mRNA
vaccination. JAMA 326, 1390–1399 (2021).
18. Diaz, G. A. et al. Myocarditis and pericarditis after vaccination for COVID-19.
JAMA 326, 1210–1212 (2021).
19. Su, J. R. Myopericarditis following COVID-19 vaccination: Updates from the
Vaccine Adverse Event Reporting System (VAERS). https://www.cdc.gov/
vaccines/acip/meetings/downloads/slides-2021-10-20-21/07-COVID-Su-508.
pdf (2021).
20. Lane, S. & Shakir, S. Reports of myocarditis and pericarditis following mRNA
COVID-19 vaccines: A review of spontaneously reported data from the UK, Europe,
and the US. 2021.09.09.21263342 https://www.medrxiv.org/content/10.1101/2021.
09.09.21263342v1, https://doi.org/10.1101/2021.09.09.21263342 (2021).
21. Chua, G. T. et al. Epidemiology of Acute Myocarditis/Pericarditis in Hong
Kong Adolescents Following Comirnaty Vaccination. Clin. Infect. Dis. Off.
Publ. Infect. Dis. Soc. Am. ciab989. https://doi.org/10.1093/cid/ciab989 (2021).
22. Mevorach, D. et al. Myocarditis after BNT162b2 vaccination in Israeli adolescents.
N. Engl. J. Med. 998–999. https://doi.org/10.1056/NEJMc2116999 (2022).
23. Kytö, V., Sipilä, J. & Rautava, P. The effects of gender and age on occurrence
of clinically suspected myocarditis in adulthood. Heart 99, 1681–1684 (2013).
24. Fairweather, D., Cooper, L. T. & Blauwet, L. A. Sex and gender differences in
myocarditis and dilated cardiomyopathy. Curr. Probl. Cardiol. 38, 7–46
(2013).
25. Heymans, S. & Cooper, L. T. Myocarditis after COVID-19 mRNA vaccination:
clinical observations and potential mechanisms. Nat. Rev. Cardiol. 1–3.
https://doi.org/10.1038/s41569-021-00662-w (2021).
26. Tschöpe, C. et al. Myocarditis and in”ammatory cardiomyopathy: current
evidence and future directions. Nat. Rev. Cardiol. 18, 169–193 (2021).
27. Launay, T. et al. Common communicable diseases in the general population in
France during the COVID-19 pandemic. PLOS ONE 16, e0258391 (2021).
28. Li, X. et al. Myocarditis following COVID-19 BNT162b2 vaccination among
adolescents in Hong Kong. JAMA Pediatr. https://doi.org/10.1001/jamapediatrics.
2022.0101 (2022).
29. Hernán, M. A. Causal analyses of existing databases: no power calculations
required. J. Clin. Epidemiol. https://doi.org/10.1016/j.jclinepi.2021.08.028
(2021).
30. Semenzato, L. et al. Chronic diseases, health conditions and risk of COVID-
19-related hospitalization and in-hospital mortality during the !rst wave of
the epidemic in France: a cohort study of 66 million people. Lancet Reg.
Health – Eur. 8 (2021).
31. Bezin, J. et al. The national healthcare system claims databases in France,
SNIIRAM and EGB: powerful tools for pharmacoepidemiology.
Pharmacoepidemiol. Drug Saf. 26, 954–962 (2017).
32. Hékimian, G. et al. Diagnostic et prise en charge des myocardites. Médecine
Intensive Réanimation https://doi.org/10.1007/s13546-017-1273-4 (2017).
33. Adler, Y. et al. 2015 ESC Guidelines for the diagnosis and management of
pericardial diseases: The Task Force for the Diagnosis and Management of
Pericardial Diseases of the European Society of Cardiology (ESC)Endorsed by:
The European Association for Cardio-Thoracic Surgery (EACTS). Eur. Heart
J. 36, 2921–2964 (2015).
34. Rey, G., Jougla, E., Fouillet, A. & Hémon, D. Ecological association between a
deprivation index and mortality in France over the period 1997–2001:
variations with spatial scale, degree of urbanicity, age, gender and cause of
death. BMC Public Health 9, 33 (2009).
35. Rothman, K. J., Greenland, S. & Lash, T. L. Modern Epidemiology. (Lippincott
Williams & Wilkins, 2008).
36. Coughlin, S. S., Benichou, J. & Weed, D. L. Attributable risk estimation in
case-control studies. Epidemiol. Rev. 16, 51–64 (1994).
37. Greenland, S. Variance estimators for attributable fraction estimates
consistent in both large strata and sparse data. Stat. Med. 6, 701–708
(1987).
38. Steenland, K. & Armstrong, B. An overview of methods for calculating the
burden of disease due to speci!c risk factors. Epidemiology 17, 512–519
(2006).
39. R Core Team. R: A language and environment for statistical computing. https://
www.R-project.org/ (2019).
40. Therneau, T. A package for survival analysis in R. 96 (2021).
41. Le Vu, S. myope2. https://doi.org/10.5281/zenodo.6583550.
Author contributions
S.L.V., M.B., A.W., R.D.S. and M.Z. conceived the study. A.W., R.D.S. and M.Z.
supervised the project. M.B. and J.D. carried out the clinical data collection and data
curation. S.L.V. and M.B. designed and performed the statistical analyses with M.J.J., B.B.
and J.B. providing input. S.L.V. wrote the !rst draft of the manuscript. All authors
interpreted the results, provided critical revision of the manuscript and approved its !nal
version for submission.
Competing interests
The authors declare no competing interests.
Additional information
Supplementary information The online version contains supplementary material
available at https://doi.org/10.1038/s41467-022-31401-5.
Correspondence and requests for materials should be addressed to Stéphane Le Vu.
Peer review information Nature Communications thanks Ian Wong and the other,
anonymous, reviewer(s) for their contribution to the peer review of this work. Peer
reviewer reports are available.
Reprints and permission information is available at http://www.nature.com/reprints
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional af!liations.
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-31401-5
8 NATURE COMMUNICATIONS | ��������(2022)�13:3633� | https://doi.org/10.1038/s41467-022-31401-5 | www.nature.com/naturecommunications
Open Access This article is licensed under a Creative Commons
Attribution 4.0 International License, which permits use, sharing,
adaptation, distribution and reproduction in any medium or format, as long as you give
appropriate credit to the original author(s) and the source, provide a link to the Creative
Commons license, and indicate if changes were made. The images or other third party
material in this article are included in the article’s Creative Commons license, unless
indicated otherwise in a credit line to the material. If material is not included in the
article’s Creative Commons license and your intended use is not permitted by statutory
regulation or exceeds the permitted use, you will need to obtain permission directly from
the copyright holder. To view a copy of this license, visit http://creativecommons.org/
licenses/by/4.0/.
© The Author(s) 2022
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-31401-5 ARTICLE
NATURE COMMUNICATIONS | ��������(2022)�13:3633� | https://doi.org/10.1038/s41467-022-31401-5 | www.nature.com/naturecommunications 9
!”#!$%&'(!
!”#$%&’
Citation: Aldén, M.; Olofsson Falla,
F.; Yang, D.; Barghouth, M.; Luan, C.;
Rasmussen, M.; De Marinis, Y.
Intracellular Reverse Transcription of
Pfizer BioNTech COVID-19 mRNA
Vaccine BNT162b2 In Vitro in Human
Liver Cell Line. Curr. Issues Mol. Biol.
2022, 44, 1115–1126.
https://doi.org/10.3390/
cimb44030073
Academic Editor: Stephen Malnick
Received: 18 January 2022
Accepted: 23 February 2022
Published: 25 February 2022
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
Copyright: © 2022 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
Article
Intracellular Reverse Transcription of Pfizer BioNTech
COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver
Cell Line
Markus Aldén 1 , Francisko Olofsson Falla 1, Daowei Yang 1, Mohammad Barghouth 1, Cheng Luan 1,
Magnus Rasmussen 2 and Yang De Marinis 1,*
1 Department of Clinical Sciences, Lund University, 20502 Malmö, Sweden; ma7440al-s@student.lu.se (M.A.);
francisko.olofsson@gmail.com (F.O.F.); daowei.yang@med.lu.se (D.Y.);
mohammad.barghouth@med.lu.se (M.B.); cheng.luan@med.lu.se (C.L.)
2 Infection Medicine, Department of Clinical Sciences, Lund University, 22362 Lund, Sweden;
magnus.rasmussen@med.lu.se
* Correspondence: yang.de_marinis@med.lu.se
Abstract: Preclinical studies of COVID-19 mRNA vaccine BNT162b2, developed by Pfizer and
BioNTech, showed reversible hepatic effects in animals that received the BNT162b2 injection.
Furthermore, a recent study showed that SARS-CoV-2 RNA can be reverse-transcribed and in-
tegrated into the genome of human cells. In this study, we investigated the effect of BNT162b2 on
the human liver cell line Huh7 in vitro. Huh7 cells were exposed to BNT162b2, and quantitative
PCR was performed on RNA extracted from the cells. We detected high levels of BNT162b2 in Huh7
cells and changes in gene expression of long interspersed nuclear element-1 (LINE-1), which is an
endogenous reverse transcriptase. Immunohistochemistry using antibody binding to LINE-1 open
reading frame-1 RNA-binding protein (ORFp1) on Huh7 cells treated with BNT162b2 indicated
increased nucleus distribution of LINE-1. PCR on genomic DNA of Huh7 cells exposed to BNT162b2
amplified the DNA sequence unique to BNT162b2. Our results indicate a fast up-take of BNT162b2
into human liver cell line Huh7, leading to changes in LINE-1 expression and distribution. We also
show that BNT162b2 mRNA is reverse transcribed intracellularly into DNA in as fast as 6 h upon
BNT162b2 exposure.
Keywords: COVID-19 mRNA vaccine; BNT162b2; liver; reverse transcription; LINE-1; Huh7
1. Introduction
Coronavirus disease 2019 (COVID-19) caused by severe acute respiratory syndrome
coronavirus 2 (SARS-CoV-2) was announced by the World Health Organization (WHO)
as a global pandemic on 11 March 2020, and it emerged as a devasting health crisis.
As of February 2022, COVID-19 has led to over 430 million reported infection cases and
5.9 million deaths worldwide [1]. Effective and safe vaccines are urgently needed to reduce
the morbidity and mortality rates associated with COVID-19.
Several vaccines for COVID-19 have been developed, with particular focus on mRNA
vaccines (by Pfizer-BioNTech and Moderna), replication-defective recombinant adenoviral
vector vaccines (by Janssen-Johnson and Johnson, Astra-Zeneca, Sputnik-V, and CanSino),
and inactivated vaccines (by Sinopharm, Bharat Biotech and Sinovac). The mRNA vaccine
has the advantages of being flexible and efficient in immunogen design and manufacturing,
and currently, numerous vaccine candidates are in various stages of development and
application. Specifically, COVID-19 mRNA vaccine BNT162b2 developed by Pfizer and
BioNTech has been evaluated in successful clinical trials [2–4] and administered in national
COVID-19 vaccination campaigns in different regions around the world [5–8].
BNT162b2 is a lipid nanoparticle (LNP)–encapsulated, nucleoside-modified RNA
vaccine (modRNA) and encodes the full-length of SARS-CoV-2 spike (S) protein, modified
Curr. Issues Mol. Biol. 2022, 44, 1115–1126. https://doi.org/10.3390/cimb44030073 https://www.mdpi.com/journal/cimb
Curr. Issues Mol. Biol. 2022, 44 1116
by two proline mutations to ensure antigenically optimal pre-fusion conformation, which
mimics the intact virus to elicit virus-neutralizing antibodies [3]. Consistent with random-
ized clinical trials, BNT162b2 showed high efficiency in a wide range of COVID-19-related
outcomes in a real-world setting [5]. Nevertheless, many challenges remain, including
monitoring for long-term safety and efficacy of the vaccine. This warrants further evalua-
tion and investigations. The safety profile of BNT162b2 is currently only available from
short-term clinical studies. Less common adverse effects of BNT162b2 have been reported,
including pericarditis, arrhythmia, deep-vein thrombosis, pulmonary embolism, myocar-
dial infarction, intracranial hemorrhage, and thrombocytopenia [4,9–20]. There are also
studies that report adverse effects observed in other types of vaccines [21–24]. To better
understand mechanisms underlying vaccine-related adverse effects, clinical investigations
as well as cellular and molecular analyses are needed.
A recent study showed that SARS-CoV-2 RNAs can be reverse-transcribed and inte-
grated into the genome of human cells [25]. This gives rise to the question of if this may also
occur with BNT162b2, which encodes partial SARS-CoV-2 RNA. In pharmacokinetics data
provided by Pfizer to European Medicines Agency (EMA), BNT162b2 biodistribution was
studied in mice and rats by intra-muscular injection with radiolabeled LNP and luciferase
modRNA. Radioactivity was detected in most tissues from the first time point (0.25 h), and
results showed that the injection site and the liver were the major sites of distribution, with
maximum concentrations observed at 8–48 h post-dose [26]. Furthermore, in animals that
received the BNT162b2 injection, reversible hepatic effects were observed, including en-
larged liver, vacuolation, increased gamma glutamyl transferase (�GT) levels, and increased
levels of aspartate transaminase (AST) and alkaline phosphatase (ALP) [26]. Transient
hepatic effects induced by LNP delivery systems have been reported previously [27–30],
nevertheless, it has also been shown that the empty LNP without modRNA alone does not
introduce any significant liver injury [27]. Therefore, in this study, we aim to examine the
effect of BNT162b2 on a human liver cell line in vitro and investigate if BNT162b2 can be
reverse transcribed into DNA through endogenous mechanisms.
2. Materials and Methods
2.1. Cell Culture
Huh7 cells (JCRB Cell Bank, Osaka, Japan) were cultured in 37 �C at 5% CO2 with
DMEM medium (HyClone, HYCLSH30243.01) supplemented with 10% (v/v) fetal bovine
serum (Sigma-Aldrich, F7524-500ML, Burlington, MA, USA) and 1% (v/v) Penicillin-
Streptomycin (HyClone, SV30010, Logan, UT, USA). For BNT162b2 treatment, Huh7 cells
were seeded with a density of 200,000 cells/well in 24-well plates. BNT162b2 mRNA vaccine
(Pfizer BioNTech, New York, NY, USA) was diluted with sterile 0.9% sodium chloride
injection, USP into a final concentration of 100 µg/mL as described in the manufacturer’s
guideline [31]. BNT162b2 suspension was then added in cell culture media to reach
final concentrations of 0.5, 1.0, or 2.0 µg/mL. Huh7 cells were incubated with or without
BNT162b2 for 6, 24, and 48 h. Cells were washed thoroughly with PBS and harvested by
trypsinization and stored in �80 �C until further use.
2.2. REAL-TIME RT-QPCR
RNA from the cells was extracted with RNeasy Plus Mini Kit (Qiagen, 74134, Hilden,
Germany) following the manufacturer’s protocol. RT-PCR was performed using RevertAid
First Strand cDNA Synthesis kit (Thermo Fisher Scientific, K1622, Waltham, MA, USA)
following the manufacturers protocol. Real-time qPCR was performed using Maxima SYBR
Green/ROX qPCR Master Mix (Thermo Fisher Scientific, K0222, Waltham, MA, USA) with
primers for BNT162b2, LINE-1 and housekeeping genes ACTB and GAPDH (Table 1).
Curr. Issues Mol. Biol. 2022, 44 1117
Table 1. Primer sequences of RT-qPCR and PCR.
Target Sequence
ACTB forward CCTCGCCTTTGCCGATCC
ACTB reverse GGATCTTCATGAGGTAGTCAGTC
GAPDH forward CTCTGCTCCTCCTGTTCGAC
GAPDH reverse TTAAAAGCAGCCCTGGTGAC
LINE-1 forward TAACCAATACAGAGAAGTGC
LINE-1 reverse GATAATATCCTGCAGAGTGT
BNT162b2 forward CGAGGTGGCCAAGAATCTGA
BNT162b2 reverse TAGGCTAAGCGTTTTGAGCTG
2.3. Immunofluorescence Staining and Confocal Imaging
Huh7 cells were cultured in eight-chamber slides (LAB-TEK, 154534, Santa Cruz, CA,
USA) with a density of 40,000 cells/well, with or without BNT162b2 (0.5, 1 or 2 µg/mL) for
6 h. Immunohistochemistry was performed using primary antibody anti-LINE-1 ORF1p
mouse monoclonal antibody (Merck, 3574308, Kenilworth, NJ, USA), secondary antibody
Cy3 Donkey anti-mouse (Jackson ImmunoResearch, West Grove, PA, USA), and Hoechst
(Life technologies, 34850, Carlsbad, CA, USA), following the protocol from Thermo Fisher
(Waltham, MA, USA). Two images per condition were taken using a Zeiss LSM 800 and a
63X oil immersion objective, and the staining intensity was quantified on the individual
whole cell area and the nucleus area on 15 cells per image by ImageJ 1.53c. LINE-1 staining
intensity for the cytosol was calculated by subtracting the intensity of the nucleus from that
of the whole cell. All images of the cells were assigned a random number to prevent bias.
To mark the nuclei (determined by the Hoechst staining) and the whole cells (determined
by the borders of the LINE-1 fluorescence), the Freehand selection tool was used. These
areas were then measured, and the mean intensity was used to compare the groups.
2.4. Genomic DNA Purification, PCR Amplification, Agarose Gel Purification, and
Sanger Sequencing
Genomic DNA was extracted from cell pellets with PBND buffer (10 mM Tris-HCl
pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 0.45% NP-40, 0.45% Tween-20) according to protocol
described previously [32]. To remove residual RNA from the DNA preparation, RNase
(100 µg/mL, Qiagen, Hilden, Germany) was added to the DNA preparation and incubated
at 37 �C for 3 h, followed by 5 min at 95 �C. PCR was then performed using primers
targeting BNT162b2 (sequences are shown in Table 1), with the following program: 5 min
at 95 �C, 35 cycles of 95 �C for 30 s, 58 �C for 30 s, and 72 �C for 1 min; finally, 72 �C for
5 min and 12 �C for 5 min. PCR products were run on 1.4% (w/v) agarose gel. Bands
corresponding to the amplicons of the expected size (444 bps) were cut out and DNA
was extracted using QIAquick PCR Purification Kit (Qiagen, 28104, Hilden, Germany),
following the manufacturer’s instructions. The sequence of the DNA amplicon was verified
by Sanger sequencing (Eurofins Genomics, Ebersberg, Germany).
Statistics
Statistical comparisons were performed using two-tailed Student’s t-test and ANOVA. Data
are expressed as the mean ± SEM or ± SD. Differences with p < 0.05 are considered significant.
2.5. Ethical Statements
The Huh7 cell line was obtained from Japanese Collection of Research Bioresources
(JCRB) Cell Bank.
Curr. Issues Mol. Biol. 2022, 44 1118
3. Results
3.1. BNT162b2 Enters Human Liver Cell Line Huh7 Cells at High Efficiency
To determine if BNT162b2 enters human liver cells, we exposed human liver cell
line Huh7 to BNT162b2. In a previous study on the uptake kinetics of LNP delivery in
Huh7 cells, the maximum biological efficacy of LNP was observed between 4–7 h [33].
Therefore, in our study, Huh7 cells were cultured with or without increasing concentrations
of BNT162b2 (0.5, 1.0 and 2.0 µg/mL) for 6, 24, and 48 h. RNA was extracted from cells
and a real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR)
was performed using primers targeting the BNT162b2 sequence, as illustrated in Figure 1.
The full sequence of BNT162b2 is publicly available [34] and contains a two-nucleotides cap;
50- untranslated region (UTR) that incorporates the 50 -UTR of a human ↵-globin gene; the
full-length of SARS-CoV-2 S protein with two proline mutations; 30-UTR that incorporates
the human mitochondrial 12S rRNA (mtRNR1) segment and human AES/TLE5 gene
segment with two C!U mutations; poly(A) tail. Detailed analysis of the S protein sequence
in BNT162b2 revealed 124 sequences that are 100% identical to human genomic sequences
and three sequences with only one nucleotide (nt) mismatch in 19–26 nts (Table S1, see
Supplementary Materials). To detect BNT162b2 RNA level, we designed primers with
forward primer located in SARS-CoV-2 S protein regions and reverse primer in 30-UTR,
which allows detection of PCR amplicon unique to BNT162b2 without unspecific binding
of the primers to human genomic regions.
Figure 1. PCR primer set used to detect mRNA level and reverse-transcription of BNT162b2. Illustra-
tion of BNT162b2 was adapted from previously described literature [34].
RT-qPCR results showed that Huh7 cells treated with BNT162b2 had high levels of
BNT162b2 mRNA relative to housekeeping genes at 6, 24, and 48 h (Figure 2, presented in
logged 2�DDCT due to exceptionally high levels). The three BNT162b2 concentrations led to
similar intracellular BNT162b2 mRNA levels at the different time points, except that the
significant difference between 1.0 and 2.0 µg/mL was observed at 48 h. BNT162b2 mRNA
levels were significantly decreased at 24 h compared to 6 h, but increased again at 48 h.
Curr. Issues Mol. Biol. 2022, 44 1119
Figure 2. BNT162b2 mRNA levels in Huh7 cells treated with BNT162b2. Huh7 cells were treated
without (Ctrl) or with 0.5 (V1), 1 (V2), and 2 µg/mL (V3) of BNT162b2 for 6 (green dots), 24 (orange
dots), and 48 h (blue dots). RNA was purified and qPCR was performed using primers targeting
BNT162b2. RNA levels of BNT162b2 are presented as logged 2�DDCT values relative to house-keeping
genes GAPDH and ACTB. Results are from five independent experiments (n = 5). Differences between
respective groups were analyzed using two-tailed Student’s t-test. Data are expressed as the mean
± SEM. (* p < 0.05; ** p < 0.01; *** p < 0.001 vs. respective control at each time point, or as indicated).
3.2. Effect of BNT162b2 on Human Endogenous Reverse Transcriptase Long Interspersed Nuclear
Element-1 (LINE-1)
Here we examined the effect of BNT162b2 on LINE-1 gene expression. RT-qPCR
was performed on RNA purified from Huh7 cells treated with BNT162b2 (0, 0.5, 1.0, and
2.0 µg/mL) for 6, 24, and 48 h, using primers targeting LINE-1. Significantly increased
LINE-1 expression compared to control was observed at 6 h by 2.0 µg/mL BNT162b2, while
lower BNT162b2 concentrations decreased LINE-1 expression at all time points (Figure 3).
Figure 3. LINE-1 mRNA levels in Huh7 cells treated with BNT162b2. Huh7 cells were treated without
(Ctrl) or with 0.5 (V1), 1 (V2), and 2 µg/mL (V3) of BNT162b2 for 6 (green dots), 24 (red dots), and 48 h
(blue dots). RNA was purified and qPCR was performed using primers targeting LINE-1. RNA levels
of LINE-1 are presented as 2�DDCT values relative to house-keeping genes GAPDH and ACTB. Results
are from five independent experiments (n = 5). Differences between respective groups were analyzed
using two-tailed Student’s t-test. Data are expressed as the mean ± SEM. (* p < 0.05; ** p < 0.01;
*** p < 0.001 vs. respective control at each time point, or as indicated; † p < 0.05 vs. 6 h-Ctrl).
Curr. Issues Mol. Biol. 2022, 44 1120
Next, we studied the effect of BNT162b2 on LINE-1 protein level. The full-length
LINE-1 consists of a 50 untranslated region (UTR), two open reading frames (ORFs), ORF1
and ORF2, and a 30UTR, of which ORF1 is an RNA binding protein with chaperone
activity. The retrotransposition activity of LINE-1 has been demonstrated to involve ORF1
translocation to the nucleus [35]. Huh7 cells treated with or without BNT162b2 (0.5,
1.0 and 2.0 µg/mL) for 6 h were fixed and stained with antibodies binding to LINE-1
ORF1p, and DNA-specific probe Hoechst for visualization of cell nucleus (Figure 4a).
Quantification of immunofluorescence staining intensity showed that BNT162b2 increased
LINE-1 ORF1p protein levels in both the whole cell area and nucleus at all concentrations
tested (Figure 4b–d).
Figure 4. Immunohistochemistry of Huh7 cells treated with BNT162b2 on LINE-1 protein distribution.
Huh7 cells were treated without (Ctrl) or with 0.5, 1, and 2 µg/mL of BNT162b2 for 6 h. Cells were
fixed and stained with antibodies binding to LINE-1 ORF1p (red) and DNA-specific probe Hoechst
for visualization of cell nucleus (blue). (a) Representative images of LINE-1 expression in Huh7
cells treated with or without BNT162b2. (b–d) Quantification of LINE-1 protein in whole cell area
(b), cytosol (c), and nucleus (d). All data were analyzed using One-Way ANOVA, and graphs were
created using GraphPad Prism V 9.2. All data is presented as mean ± SD (** p < 0.01; *** p < 0.001;
**** p < 0.0001 as indicated).
Curr. Issues Mol. Biol. 2022, 44 1121
3.3. Detection of Reverse Transcribed BNT162b2 DNA in Huh7 Cells
A previous study has shown that entry of LINE-1 protein into the nucleus is associated
with retrotransposition [35]. In the immunofluorescence staining experiment described
above, increased levels of LINE-1 in the nucleus were observed already at the lowest
concentration of BNT162b2 (0.5 µg/mL). To examine if BNT162b2 is reversely transcribed
into DNA when LINE-1 is elevated, we purified genomic DNA from Huh7 cells treated
with 0.5 µg/mL of BNT162b2 for 6, 24, and 48 h. Purified DNA was treated with RNase
to remove RNA and subjected to PCR using primers targeting BNT162b2, as illustrated
in Figure 1. Amplified DNA fragments were then visualized by electrophoresis and gel-
purified (Figure 5). BNT162b2 DNA amplicons were detected in all three time points (6,
24, and 48 h). Sanger sequencing confirmed that the DNA amplicons were identical to the
BNT162b2 sequence flanked by the primers (Table 2). To ensure that the DNA amplicons
were derived from DNA but not BNT162b2 RNA, we also performed PCR on RNA purified
from Huh7 cells treated with 0.5 µg/mL BNT162b2 for 6 h, with or without RNase treatment
(Ctrl 5 and 6 in Figure 5), and no amplicon was detected in the RNA samples subjected
to PCR.
Figure 5. Detection of DNA amplicons of BNT162b2 in Huh7 cells treated with BNT162b2. Huh7 cells
were treated without (Ctrl) or with 0.5 µg/mL of BNT162b2 for 6, 24, and 48 h. Genomic DNA was
purified and digested with 100 µg/mL RNase. PCR was run on all samples with primers targeting
BNT162b2, as shown in Figure 1 and Table 1. DNA amplicons (444 bps) were visualized on agarose
gel. BNT: BNT162b2; L: DNA ladder; Ctrl1: cultured Huh7 cells; Ctrl2: Huh7 cells without BNT162b2
treatment collected at 6 h; Ctrl3: Huh7 cells without BNT162b2 treatment collected at 24 h; Ctrl4:
Huh7 cells without BNT162b2 treatment collected at 48 h; Ctrl5: RNA from Huh7 cells treated with
0.5 µg/mL of BNT162b2 for 6 h; Ctrl6: RNA from Huh7 cells treated with 0.5 µg/mL of BNT162b2
for 6 h, digested with RNase.
Table 2. Sanger sequencing result of the BNT162b2 amplicon.
CGAGGTGGCCAAGAATCTGAACGAGAGCCTGATCGACCTGCAAGAACTGGGGAAGT
ACGAGCAGTACATCAAGTGGCCCTGGTACATCTGGCTGGGCTTTATCGCCGGACTGATTG
CCATCGTGATGGTCACAATCATGCTGTGTTGCATGACCAGCTGCTGTAGCTGCCTGAAGG
GCTGTTGTAGCTGTGGCAGCTGCTGCAAGTTCGACGAGGACGATTCTGAGCCCGTGCTGA
AGGGCGTGAAACTGCACTACACATGATGACTCGAGCTGGTACTGCATGCACGCAATGCTA
GCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGC
TCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGC
AGCAATGCAGCTCAAAACGCTTAGCCTA
Curr. Issues Mol. Biol. 2022, 44 1122
4. Discussion
In this study we present evidence that COVID-19 mRNA vaccine BNT162b2 is able
to enter the human liver cell line Huh7 in vitro. BNT162b2 mRNA is reverse transcribed
intracellularly into DNA as fast as 6 h after BNT162b2 exposure. A possible mechanism for
reverse transcription is through endogenous reverse transcriptase LINE-1, and the nucleus
protein distribution of LINE-1 is elevated by BNT162b2.
Intracellular accumulation of LNP in hepatocytes has been demonstrated in vivo [36].
A preclinical study on BNT162b2 showed that BNT162b2 enters the human cell line
HEK293T cells and leads to robust expression of BNT162b2 antigen [37]. Therefore, in this
study, we first investigated the entry of BNT162b2 in the human liver cell line Huh7 cells.
The choice of BNT162b2 concentrations used in this study warrants explanation. BNT162b2
is administered as a series of two doses three weeks apart, and each dose contains 30 µg
of BNT162b2 in a volume of 0.3 mL, which makes the local concentration at the injection
site at the highest 100 µg/mL [31]. A previous study on mRNA vaccines against H10N8
and H7N9 influenza viruses using a similar LNP delivery system showed that the mRNA
vaccine can distribute rather nonspecifically to several organs such as liver, spleen, heart,
kidney, lung, and brain, and the concentration in the liver is roughly 100 times lower than
that of the intra-muscular injection site [38]. In the assessment report on BNT162b2 pro-
vided to EMA by Pfizer, the pharmacokinetic distribution studies in rats demonstrated that
a relatively large proportion (up to 18%) of the total dose distributes to the liver [26]. We
therefore chose to use 0.5, 1, and 2 µg/mL of vaccine in our experiments on the liver cells.
However, the effect of a broader range of lower and higher concentrations of BNT162b2
should also be verified in future studies.
In the current study, we employed a human liver cell line for in vitro investigation.
It is worth investigating if the liver cells also present the vaccine-derived SARS-CoV-2 spike
protein, which could potentially make the liver cells targets for previously primed spike
protein reactive cytotoxic T cells. There has been case reports on individuals who developed
autoimmune hepatitis [39] after BNT162b2 vaccination. To obtain better understanding
of the potential effects of BNT162b2 on liver function, in vivo models are desired for
future studies.
In the BNT162b2 toxicity report, no genotoxicity nor carcinogenicity studies have
been provided [26]. Our study shows that BNT162b2 can be reverse transcribed to DNA
in liver cell line Huh7, and this may give rise to the concern if BNT162b2-derived DNA
may be integrated into the host genome and affect the integrity of genomic DNA, which
may potentially mediate genotoxic side effects. At this stage, we do not know if DNA
reverse transcribed from BNT162b2 is integrated into the cell genome. Further studies
are needed to demonstrate the effect of BNT162b2 on genomic integrity, including whole
genome sequencing of cells exposed to BNT162b2, as well as tissues from human subjects
who received BNT162b2 vaccination.
Human autonomous retrotransposon LINE-1 is a cellular endogenous reverse tran-
scriptase and the only remaining active transposon in humans, able to retrotranspose
itself and other nonautonomous elements [40,41], and ~17% of the human genome are
comprised of LINE-1 sequences [42]. The nonautonomous Alu elements, short, interspersed
nucleotide elements (SINEs), variable-number-of-tandem-repeats (VNTR), as well as cellu-
lar mRNA-processed pseudogenes, are retrotransposed by the LINE-1 retrotransposition
proteins working in trans [43,44]. A recent study showed that endogenous LINE-1 mediates
reverse transcription and integration of SARS-CoV-2 sequences in the genomes of infected
human cells [25]. Furthermore, expression of endogenous LINE-1 is often increased upon
viral infection, including SARS-CoV-2 infection [45–47]. Previous studies showed that
LINE-1 retrotransposition activity is regulated by RNA metabolism [48,49], DNA damage
response [50], and autophagy [51]. Efficient retrotransposition of LINE-1 is often associ-
ated with cell cycle and nuclear envelope breakdown during mitosis [52,53], as well as
exogenous retroviruses [54,55], which promotes entrance of LINE-1 into the nucleus. In our
study, we observed increased LINE-1 ORF1p distribution as determined by immunohisto-
Curr. Issues Mol. Biol. 2022, 44 1123
chemistry in the nucleus by BNT162b2 at all concentrations tested (0.5, 1, and 2 µg/mL),
while elevated LINE-1 gene expression was detected at the highest BNT162b2 concentration
(2 µg/mL). It is worth noting that gene transcription is regulated by chromatin modifica-
tions, transcription factor regulation, and the rate of RNA degradation, while translational
regulation of protein involves ribosome recruitment on the initiation codon, modulation of
peptide elongation, termination of protein synthesis, or ribosome biogenesis. These two
processes are controlled by different mechanisms, and therefore they may not always show
the same change patterns in response to external challenges. The exact regulation of LINE-1
activity in response to BNT162b2 merits further study.
The cell model that we used in this study is a carcinoma cell line, with active DNA
replication which differs from non-dividing somatic cells. It has also been shown that
Huh7 cells display significant different gene and protein expression including upregulated
proteins involved in RNA metabolism [56]. However, cell proliferation is also active in
several human tissues such as the bone marrow or basal layers of epithelia as well as
during embryogenesis, and it is therefore necessary to examine the effect of BNT162b2
on genomic integrity under such conditions. Furthermore, effective retrotransposition of
LINE-1 has also been reported in non-dividing and terminally differentiated cells, such as
human neurons [57,58].
The Pfizer EMA assessment report also showed that BNT162b2 distributes in the
spleen (<1.1%), adrenal glands (<0.1%), as well as low and measurable radioactivity in the
ovaries and testes (<0.1%) [26]. Furthermore, no data on placental transfer of BNT162b2 is
available from Pfizer EMA assessment report. Our results showed that BNT162b2 mRNA
readily enters Huh7 cells at a concentration (0.5 µg/mL) corresponding to 0.5% of the local
injection site concentration, induce changes in LINE-1 gene and protein expression, and
within 6 h, reverse transcription of BNT162b2 can be detected. It is therefore important to
investigate further the effect of BNT162b2 on other cell types and tissues both in vitro and
in vivo.
5. Conclusions
Our study is the first in vitro study on the effect of COVID-19 mRNA vaccine BNT162b2
on human liver cell line. We present evidence on fast entry of BNT162b2 into the cells and
subsequent intracellular reverse transcription of BNT162b2 mRNA into DNA.
Supplementary Materials: The following supporting information can be downloaded at: https:
//www.mdpi.com/article/10.3390/cimb44030073/s1.
Author Contributions: M.A., F.O.F., D.Y., M.B. and C.L. performed in vitro experiments. M.A. and
F.O.F. performed data analysis. M.R. and Y.D.M. contributed to the implementation of the research,
designed, and supervised the study. Y.D.M. wrote the paper with input from all authors. All authors
have read and agreed to the published version of the manuscript.
Funding: This study was supported by the Swedish Research Council, Strategic Research Area Exo-
diab, Dnr 2009-1039, the Swedish Government Fund for Clinical Research (ALF) and the foundation
of Skåne University Hospital.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: All data supporting the findings of this study are available within the
article and supporting information.
Acknowledgments: The authors thank Sven Haidl, Maria Josephson, Enming Zhang, Jia-Yi Li,
Caroline Haikal, and Pradeep Bompada for their support to this study.
Conflicts of Interest: The authors declare no conflict of interest.
Curr. Issues Mol. Biol. 2022, 44 1124
References
1. World Health Organization. Coronavirus (COVID-19) Dashboard. Available online: https://covid19.who.int/ (accessed on
22 February 2022).
2. Mulligan, M.J.; Lyke, K.E.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart, S.; Neuzil, K.; Raabe, V.; Bailey, R.; Swanson, K.A.; et al.
Phase I/II study of COVID-19 RNA vaccine BNT162b1 in adults. Nature 2020, 586, 589–593. [CrossRef] [PubMed]
3. Walsh, E.E.; Frenck, R.W., Jr.; Falsey, A.R.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart, S.; Neuzil, K.; Mulligan, M.J.;
Bailey, R.; et al. Safety and Immunogenicity of Two RNA-Based COVID-19 Vaccine Candidates. N. Engl. J. Med. 2020, 383,
2439–2450. [CrossRef] [PubMed]
4. Polack, F.P.; Thomas, S.J.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart, S.; Perez, J.L.; Perez Marc, G.; Moreira, E.D.; Zerbini, C.; et al.
Safety and Efficacy of the BNT162b2 mRNA COVID-19 Vaccine. N. Engl. J. Med. 2020, 383, 2603–2615. [CrossRef] [PubMed]
5. Harris, R.J.; Hall, J.A.; Zaidi, A.; Andrews, N.J.; Dunbar, J.K.; Dabrera, G. Effect of Vaccination on Household Transmission of
SARS-CoV-2 in England. N. Engl. J. Med. 2021, 385, 759–760. [CrossRef]
6. Butt, A.A.; Omer, S.B.; Yan, P.; Shaikh, O.S.; Mayr, F.B. SARS-CoV-2 Vaccine Effectiveness in a High-Risk National Population in a
Real-World Setting. Ann. Intern. Med. 2021, 174, 1404–1408. [CrossRef]
7. Dagan, N.; Barda, N.; Kepten, E.; Miron, O.; Perchik, S.; Katz, M.A.; Hernan, M.A.; Lipsitch, M.; Reis, B.; Balicer, R.D. BNT162b2
mRNA Covid-19 Vaccine in a Nationwide Mass Vaccination Setting. N. Engl. J. Med. 2021, 384, 1412–1423. [CrossRef]
8. Rossman, H.; Shilo, S.; Meir, T.; Gorfine, M.; Shalit, U.; Segal, E. COVID-19 dynamics after a national immunization program in
Israel. Nat. Med. 2021, 27, 1055–1061. [CrossRef]
9. Fan, B.E.; Shen, J.Y.; Lim, X.R.; Tu, T.M.; Chang, C.C.R.; Khin, H.S.W.; Koh, J.S.; Rao, J.P.; Lau, S.L.; Tan, G.B.; et al. Cerebral venous
thrombosis post BNT162b2 mRNA SARS-CoV-2 vaccination: A black swan event. Am. J. Hematol. 2021, 96, E357–E361. [CrossRef]
10. Larson, K.F.; Ammirati, E.; Adler, E.D.; Cooper, L.T., Jr.; Hong, K.N.; Saponara, G.; Couri, D.; Cereda, A.; Procopio, A.; Cavalotti, C.; et al.
Myocarditis After BNT162b2 and mRNA-1273 Vaccination. Circulation 2021, 144, 506–508. [CrossRef]
11. Menni, C.; Klaser, K.; May, A.; Polidori, L.; Capdevila, J.; Louca, P.; Sudre, C.H.; Nguyen, L.H.; Drew, D.A.; Merino, J.; et al. Vaccine
side-effects and SARS-CoV-2 infection after vaccination in users of the COVID Symptom Study app in the UK: A prospective
observational study. Lancet Infect. Dis. 2021, 21, 939–949. [CrossRef]
12. Hansen, T.; Titze, U.; Kulamadayil-Heidenreich, N.S.A.; Glombitza, S.; Tebbe, J.J.; Rocken, C.; Schulz, B.; Weise, M.; Wilkens, L.
First case of postmortem study in a patient vaccinated against SARS-CoV-2. Int. J. Infect. Dis. 2021, 107, 172–175. [CrossRef]
[PubMed]
13. Kadali, R.A.K.; Janagama, R.; Peruru, S.; Malayala, S.V. Side effects of BNT162b2 mRNA COVID-19 vaccine: A randomized,
cross-sectional study with detailed self-reported symptoms from healthcare workers. Int. J. Infect. Dis. 2021, 106, 376–381.
[CrossRef] [PubMed]
14. Parkash, O.; Sharko, A.; Farooqi, A.; Ying, G.W.; Sura, P. Acute Pancreatitis: A Possible Side Effect of COVID-19 Vaccine. Cureus
2021, 13, e14741. [CrossRef] [PubMed]
15. Mazzatenta, C.; Piccolo, V.; Pace, G.; Romano, I.; Argenziano, G.; Bassi, A. Purpuric lesions on the eyelids developed after
BNT162b2 mRNA COVID-19 vaccine: Another piece of SARS-CoV-2 skin puzzle? J. Eur. Acad. Dermatol. Venereol. 2021, 35,
e543–e545. [CrossRef]
16. Lee, E.J.; Cines, D.B.; Gernsheimer, T.; Kessler, C.; Michel, M.; Tarantino, M.D.; Semple, J.W.; Arnold, D.M.; Godeau, B.;
Lambert, M.P.; et al. Thrombocytopenia following Pfizer and Moderna SARS-CoV-2 vaccination. Am. J. Hematol. 2021, 96, 534–537.
[CrossRef]
17. Ishay, Y.; Kenig, A.; Tsemach-Toren, T.; Amer, R.; Rubin, L.; Hershkovitz, Y.; Kharouf, F. Autoimmune phenomena following
SARS-CoV-2 vaccination. Int. Immunopharmacol. 2021, 99, 107970. [CrossRef]
18. Das, B.B.; Kohli, U.; Ramachandran, P.; Nguyen, H.H.; Greil, G.; Hussain, T.; Tandon, A.; Kane, C.; Avula, S.; Duru, C.; et al.
Myopericarditis following mRNA COVID-19 Vaccination in Adolescents 12 through 18 Years of Age. J. Pediatr. 2021, 238, 26–32.e1.
[CrossRef]
19. McLaurin-Jiang, S.; Garner, C.D.; Krutsch, K.; Hale, T.W. Maternal and Child Symptoms Following COVID-19 Vaccination Among
Breastfeeding Mothers. Breastfeed. Med. 2021, 16, 702–709. [CrossRef]
20. Barda, N.; Dagan, N.; Ben-Shlomo, Y.; Kepten, E.; Waxman, J.; Ohana, R.; Hernan, M.A.; Lipsitch, M.; Kohane, I.; Netzer, D.; et al.
Safety of the BNT162b2 mRNA Covid-19 Vaccine in a Nationwide Setting. N. Engl. J. Med. 2021, 385, 1078–1090. [CrossRef]
21. Baden, L.R.; El Sahly, H.M.; Essink, B.; Kotloff, K.; Frey, S.; Novak, R.; Diemert, D.; Spector, S.A.; Rouphael, N.; Creech, C.B.; et al.
Efficacy and Safety of the mRNA-1273 SARS-CoV-2 Vaccine. N. Engl. J. Med. 2021, 384, 403–416. [CrossRef]
22. Sadoff, J.; Gray, G.; Vandebosch, A.; Cardenas, V.; Shukarev, G.; Grinsztejn, B.; Goepfert, P.A.; Truyers, C.; Fennema, H.;
Spiessens, B.; et al. Safety and Efficacy of Single-Dose Ad26.COV2.S Vaccine against Covid-19. N. Engl. J. Med. 2021, 384,
2187–2201. [CrossRef] [PubMed]
23. Eichinger, S.; Warkentin, T.E.; Greinacher, A. Thrombotic Thrombocytopenia after ChAdOx1 nCoV-19 Vaccination. Reply. N. Engl.
J. Med. 2021, 385, e11. [CrossRef] [PubMed]
24. Doroftei, B.; Ciobica, A.; Ilie, O.D.; Maftei, R.; Ilea, C. Mini-Review Discussing the Reliability and Efficiency of COVID-19 Vaccines.
Diagnostics 2021, 11, 579. [CrossRef]
Curr. Issues Mol. Biol. 2022, 44 1125
25. Zhang, L.; Richards, A.; Barrasa, M.I.; Hughes, S.H.; Young, R.A.; Jaenisch, R. Reverse-transcribed SARS-CoV-2 RNA can integrate
into the genome of cultured human cells and can be expressed in patient-derived tissues. Proc. Natl. Acad. Sci. USA 2021, 118,
e2105968118. [CrossRef] [PubMed]
26. Available online: https://www.ema.europa.eu/en/documents/assessment-report/comirnaty-epar-public-assessment-report_
en (accessed on 24 February 2022).
27. Tanaka, H.; Takata, N.; Sakurai, Y.; Yoshida, T.; Inoue, T.; Tamagawa, S.; Nakai, Y.; Tange, K.; Yoshioka, H.; Maeki, M.; et al.
Delivery of Oligonucleotides Using a Self-Degradable Lipid-Like Material. Pharmaceutics 2021, 13, 544. [CrossRef]
28. Sedic, M.; Senn, J.J.; Lynn, A.; Laska, M.; Smith, M.; Platz, S.J.; Bolen, J.; Hoge, S.; Bulychev, A.; Jacquinet, E.; et al. Safety
Evaluation of Lipid Nanoparticle-Formulated Modified mRNA in the Sprague-Dawley Rat and Cynomolgus Monkey. Vet. Pathol.
2018, 55, 341–354. [CrossRef]
29. Sato, Y.; Matsui, H.; Yamamoto, N.; Sato, R.; Munakata, T.; Kohara, M.; Harashima, H. Highly specific delivery of siRNA to
hepatocytes circumvents endothelial cell-mediated lipid nanoparticle-associated toxicity leading to the safe and efficacious
decrease in the hepatitis B virus. J. Control. Release 2017, 266, 216–225. [CrossRef]
30. Heidel, J.D.; Yu, Z.; Liu, J.Y.; Rele, S.M.; Liang, Y.; Zeidan, R.K.; Kornbrust, D.J.; Davis, M.E. Administration in non-human
primates of escalating intravenous doses of targeted nanoparticles containing ribonucleotide reductase subunit M2 siRNA. Proc.
Natl. Acad. Sci. USA 2007, 104, 5715–5721. [CrossRef]
31. Available online: https://www.cvdvaccine-us.com/ (accessed on 24 February 2022).
32. Available online: http://bridgeslab.sph.umich.edu/protocols/index.php/Preparation_of_Tail_Samples_(for_Genotyping)
(accessed on 24 February 2022).
33. Gallud, A.; Munson, M.J.; Liu, K.; Idstrom, A.; Barriga, H.M.; Tabaei, S.; Aliakbarinodehi, N.; Ojansivu, M.; Lubart, Q.;
Doutch, J.J.; et al. Time evolution of PEG-shedding and serum protein coronation determines the cell uptake kinetics and delivery
of lipid nanoparticle. bioRxiv 2021. [CrossRef]
34. World Health Organization Messenger RNA Encoding the Full-Length SARS-CoV-2 Spike Glycoprotein. 2020. Available
online: https://web.archive.org/web/20210105162941/https://mednet-communities.net/inn/db/media/docs/11889
(accessed on 24 February 2022).
35. Mita, P.; Wudzinska, A.; Sun, X.; Andrade, J.; Nayak, S.; Kahler, D.J.; Badri, S.; LaCava, J.; Ueberheide, B.; Yun, C.Y.; et al. LINE-1
protein localization and functional dynamics during the cell cycle. Elife 2018, 7, e30058. [CrossRef]
36. Sato, Y.; Kinami, Y.; Hashiba, K.; Harashima, H. Different kinetics for the hepatic uptake of lipid nanoparticles between the
apolipoprotein E/low density lipoprotein receptor and the N-acetyl-d-galactosamine/asialoglycoprotein receptor pathway. J.
Control. Release 2020, 322, 217–226. [CrossRef]
37. Vogel, A.B.; Kanevsky, I.; Che, Y.; Swanson, K.A.; Muik, A.; Vormehr, M.; Kranz, L.M.; Walzer, K.C.; Hein, S.; Guler, A.; et al.
BNT162b vaccines protect rhesus macaques from SARS-CoV-2. Nature 2021, 592, 283–289. [CrossRef] [PubMed]
38. Bahl, K.; Senn, J.J.; Yuzhakov, O.; Bulychev, A.; Brito, L.A.; Hassett, K.J.; Laska, M.E.; Smith, M.; Almarsson, O.; Thompson, J.; et al.
Preclinical and Clinical Demonstration of Immunogenicity by mRNA Vaccines against H10N8 and H7N9 Influenza Viruses. Mol. Ther.
2017, 25, 1316–1327. [CrossRef] [PubMed]
39. Bril, F.; Al Diffalha, S.; Dean, M.; Fettig, D.M. Autoimmune hepatitis developing after coronavirus disease 2019 (COVID-19)
vaccine: Causality or casualty? J. Hepatol. 2021, 75, 222–224. [CrossRef]
40. Kazazian, H.H., Jr.; Moran, J.V. Mobile DNA in Health and Disease. N. Engl. J. Med. 2017, 377, 361–370. [CrossRef] [PubMed]
41. Coffin, J.M.; Fan, H. The Discovery of Reverse Transcriptase. Annu. Rev. Virol. 2016, 3, 29–51. [CrossRef]
42. Lander, E.S.; Linton, L.M.; Birren, B.; Nusbaum, C.; Zody, M.C.; Baldwin, J.; Devon, K.; Dewar, K.; Doyle, M.; FitzHugh, W.; et al.
Initial sequencing and analysis of the human genome. Nature 2001, 409, 860–921. [CrossRef]
43. Ostertag, E.M.; Goodier, J.L.; Zhang, Y.; Kazazian, H.H., Jr. SVA elements are nonautonomous retrotransposons that cause disease
in humans. Am. J. Hum. Genet. 2003, 73, 1444–1451. [CrossRef]
44. Hancks, D.C.; Kazazian, H.H., Jr. Active human retrotransposons: Variation and disease. Curr. Opin. Genet. Dev. 2012, 22, 191–203.
[CrossRef]
45. Jones, R.B.; Song, H.; Xu, Y.; Garrison, K.E.; Buzdin, A.A.; Anwar, N.; Hunter, D.V.; Mujib, S.; Mihajlovic, V.; Martin, E.; et al.
LINE-1 retrotransposable element DNA accumulates in HIV-1-infected cells. J. Virol. 2013, 87, 13307–13320. [CrossRef]
46. Macchietto, M.G.; Langlois, R.A.; Shen, S.S. Virus-induced transposable element expression up-regulation in human and mouse
host cells. Life Sci. Alliance 2020, 3, e201900536. [CrossRef] [PubMed]
47. Yin, Y.; Liu, X.Z.; He, X.; Zhou, L.Q. Exogenous Coronavirus Interacts With Endogenous Retrotransposon in Human Cells. Front.
Cell Infect. Microbiol. 2021, 11, 609160. [CrossRef] [PubMed]
48. Belancio, V.P.; Roy-Engel, A.M.; Deininger, P. The impact of multiple splice sites in human L1 elements. Gene 2008, 411, 38–45.
[CrossRef] [PubMed]
49. Dai, L.; Taylor, M.S.; O’Donnell, K.A.; Boeke, J.D. Poly(A) binding protein C1 is essential for efficient L1 retrotransposition and
affects L1 RNP formation. Mol. Cell Biol. 2012, 32, 4323–4336. [CrossRef]
50. Servant, G.; Streva, V.A.; Derbes, R.S.; Wijetunge, M.I.; Neeland, M.; White, T.B.; Belancio, V.P.; Roy-Engel, A.M.; Deininger, P.L.
The Nucleotide Excision Repair Pathway Limits L1 Retrotransposition. Genetics 2017, 205, 139–153. [CrossRef]
51. Guo, H.; Chitiprolu, M.; Gagnon, D.; Meng, L.; Perez-Iratxeta, C.; Lagace, D.; Gibbings, D. Autophagy supports genomic stability
by degrading retrotransposon RNA. Nat. Commun. 2014, 5, 5276. [CrossRef]
Curr. Issues Mol. Biol. 2022, 44 1126
52. Xie, Y.; Mates, L.; Ivics, Z.; Izsvak, Z.; Martin, S.L.; An, W. Cell division promotes efficient retrotransposition in a stable L1 reporter
cell line. Mob. DNA 2013, 4, 10. [CrossRef]
53. Shi, X.; Seluanov, A.; Gorbunova, V. Cell divisions are required for L1 retrotransposition. Mol. Cell Biol. 2007, 27, 1264–1270.
[CrossRef]
54. Goff, S.P. Host factors exploited by retroviruses. Nat. Rev. Microbiol 2007, 5, 253–263. [CrossRef]
55. Suzuki, Y.; Craigie, R. The road to chromatin—Nuclear entry of retroviruses. Nat. Rev. Microbiol. 2007, 5, 187–196. [CrossRef]
56. Shi, J.; Wang, X.; Lyu, L.; Jiang, H.; Zhu, H.J. Comparison of protein expression between human livers and the hepatic cell lines
HepG2, Hep3B, and Huh7 using SWATH and MRM-HR proteomics: Focusing on drug-metabolizing enzymes. Drug Metab.
Pharmacokinet. 2018, 33, 133–140. [CrossRef] [PubMed]
57. Kubo, S.; Seleme, M.C.; Soifer, H.S.; Perez, J.L.; Moran, J.V.; Kazazian, H.H., Jr.; Kasahara, N. L1 retrotransposition in nondividing
and primary human somatic cells. Proc. Natl. Acad. Sci. USA 2006, 103, 8036–8041. [CrossRef] [PubMed]
58. Macia, A.; Widmann, T.J.; Heras, S.R.; Ayllon, V.; Sanchez, L.; Benkaddour-Boumzaouad, M.; Munoz-Lopez, M.; Rubio, A.;
Amador-Cubero, S.; Blanco-Jimenez, E.; et al. Engineered LINE-1 retrotransposition in nondividing human neurons. Genome Res.
2017, 27, 335–348. [CrossRef] [PubMed]
Directions:
While established vaccines are generally safe for the vast majority of the population, it is a fact that for a minority of people, certain vaccines are contraindicated. In particular, it is well known that people with immunodeficiency are advised against receiving live attenuated vaccines.
Less-often discussed is the possibility of (for some people) of autoimmune reaction. This is not only an issue with regard to vaccines, but synthetic chemicals as well (as well as potential allergy development from cross reactivity / bystander effect some individuals’ immune systems may be predisposed to engage).
For Part 1 of your initial post, examine at least one of the three paper attachments and summarize at least one point / comment regarding your chosen document(s) in your initial post. You don’t need to read the entire document(s), but please do at least read the Abstracts, and be sure to include a comment on one point or simply a summary of the abstract in your own words.
The ”
bystander effect” or as some texts call it, ”
cross-reactivity” (
microbiology definition) is: When immune cells detect a legitimate threat in the body, sometimes “innocent bystander” molecules or body cells “get in the way of its attack” and become unfortunate targets themselves. This could include otherwise perfectly harmless food molecules, or even parts of the body such as neurons’ myelin sheaths, or pancreas cells.
Such challenges are admittedly rare, yet not nonexistent.
This first paper on autoimmunity discusses how sometimes such mechanisms can occur in response to antigens (including antigens in vaccines), and was published in 2015:
Autoimmunity paper
The following paper is more relevant to specific results of autoimmunity in response to antigens as varied as viruses or particles in certain vaccines (i.e. myocarditis and pericarditis) – this is an extremely recent paper (published June 2022):
Risks of myocarditis and pericarditis following Covid-19 mRNA vaccines
The third paragraph of the discussion section of this below paper (published recently, February 2022) discusses autoimmune mechanisms regarding the Covid spike protein getting potentially expressed in the liver in particular:
[Side note: As of the start of 2023, many, many more scientific papers documenting autoimmune adverse reactions of many more body systems have been published. I’ve cataloged 7+ such papers on vasculitis alone, as well as a very thorough report of other types of ADRs for example, if you want to see more data than I can reasonably fit into this discussion post for options.
Evidence (and further questions) regarding how Covid vaccine mRNA interacts with our genome
There are however many viral diseases for which vaccines are not even available (or viral variants for which vaccines are possibly less than 15-50% effective), which brings us to “antiviral chemicals” as a good adjunct treatment (or, in some cases, the sole treatment) option for certain diseases.
Thus, for Part 2 of your initial post, we will focus on “after-the-fact” antiviral treatment options:
Examine at least one of the below papers (or a similar one, any result of your typing in a “antiviral” of choice along with the keyword “antiviral”), and make at least one comment about it as well, as part of your initial post.
The first two papers below have been added as attachments (actually the second attachment is a list of links to a BUNCH of papers!); the rest of the papers below are in “link” form.
Remember if you want to download the “attachment”, click on the three dots to the right of the title:
Eugenol, a Component of Holy Basil (Tulsi) and Common Spice Clove, Inhibits the Interaction Between SARS-CoV-2 Spike S1 and ACE2 to Induce Therapeutic Responses – 11481_2021_Article_10028
Evidence of elderberry antiviral and immunomodulatory properties x
Pharmacoinformatic evidence for allicin, gingerol as candidates against COVID-19-associated proteases
In silico allicin induced S-thioallylation of SARS-CoV-2 main protease
Allicin inhibits SARS-CoV-2 replic
Antiviral agents for rhinovirus (a type of common cold)
How curcumin (in turmeric) interacts with Covid proteins
How piperine (in black pepper) interacts with Covid proteins
Zinc inhibits SARS-CoV RNA polymerase, and thus its replication capacity
How 9 of 48 compounds in cinnamon interact with Covid proteins
Antiviral activity of licorice extract against respiratory syncytial virus
Virucidal effect of peppermint oil on the enveloped viruses herpes simplex viruses type 1 and type 2 in vitro
Order an Essay Now & Get These Features For Free:
Turnitin Report
Formatting
Title Page
Citation
Outline
